Basic–liver, pancreas, and biliary tractSTAT3 Is Required for IL-6-gp130–Dependent Activation of Hepcidin In Vivo
Section snippets
Generation and genotyping of gp130-mutated animals
Cre gp130LoxP/LoxP hepatocyte-specific gp130–/– mice were generated by breeding alfpCre mice with mice expressing LoxP-flanked gp130 alleles. Genomic DNA was isolated and analyzed by polymerase chain reaction (PCR) as described previously.23 Gp130LoxP/LoxP mice without Cre expression were used as control (wild-type [WT]) animals.
AlfpCre gp130ΔSTAT/LoxP hepatocyte-specific gp130ΔSTAT/LoxP animals were generated by breeding alfpCre gp130LoxP/LoxP with gp130ΔSTAT/ΔSTAT knockin (KI) mice. Gp130
RNA Isolation and Analysis
After liver tissue collection, samples were immediately placed in RNAlater (Ambion, Austin, TX) solution for storage before processing. Hepatocyte RNA was prepared using TRIzol reagent according to the manufacturer’s instructions (Invitrogen, Carlsbad, CA).
Northern-Blot Analysis
Total RNA (15 μg per lane) was separated on a 1% agarose formaldehyde gel, transferred to nylon membrane (Amersham Pharmacia Biotech, UK), and ultraviolet (UV) light–crosslinked. Hepcidin probe (317–base pair [bp]) was generated by PCR from hepatic mouse RNA with the following primers: forward, 5’ACCATGGCACTCAGCACTCG3’ and reverse, 5’GCGGCTCTAGGCTATGTTTTG3’ and cloned in pcDNA3.1/V5/His-TOPO. Hybridization was performed at 42°C with random-primed 32P-labeled cDNA probes for hepcidin and β-actin.
Quantitative Reverse-Transcription PCR
The cDNA was generated by reverse transcription of 5 μg of total mouse liver RNA or isolated hepatocyte RNA, with 100 ng random hexamer (Roche, Mannheim, GmbH-Germany), 250 μM dNTPs (Promega Corp., Madison, WI), and 200 U M-MLV Reverse Transcriptase (Promega Corp., Madison, WI) in 1X reverse transcriptase buffer for 1 hour at 42°C. Expression of mouse hepcidin and GAPDH were analyzed using Platinum SYBR Green SuperMix (Invitrogen, Carlsbad, CA). The primers were as follows: SOCS3, forward
Characterization and Validation of Hepatocyte-Specific alfpgp130LoxP/LoxP,alfpgp130ΔSTAT/LoxP, and gp130Y757F/LoxP Mice
IL-6 signaling is dependent on gp130. In order to characterize IL-6–dependent regulation of hepcidin in hepatocytes in vivo, we used genetically modified animals that combine conditional KO and KI technology to modify gp130-dependent pathways in hepatocytes in vivo.27 Four different animal strains were used: alfpgp130LoxP/LoxP, alfpCre gp130ΔSTAT/LoxP, alfpCre gp130Y757F/LoxP, and WT controls.
In order to characterize the modification of gp130-dependent signaling in vivo in hepatocytes, these 4
Discussion
Hepcidin is a main player in the disturbances of iron homeostasis during inflammatory states. Anemia of inflammation, or anemia of chronic disease, is an acquired disorder commonly encountered in patients with chronic infections, malignancy, trauma, and inflammatory bowel diseases.33 It is usually mild or moderate, but it can be severe enough to require transfusions. The hallmarks of the disorder are normocytic anemia (although it can be microcytic at later stages), low serum iron, and normal
References (41)
- et al.
LEAP-1, a novel highly disulfide-bonded human peptide, exhibits antimicrobial activity
FEBS Lett
(2000) - et al.
Hepcidin, a urinary antimicrobial peptide synthesized in the liver
J Biol Chem
(2001) - et al.
A new mouse liver-specific gene, encoding a protein homologous to human antimicrobial peptide hepcidin, is overexpressed during iron overload
J Biol Chem
(2001) - et al.
C/EBPalpha regulates hepatic transcription of hepcidin, an antimicrobial peptide and regulator of iron metabolismCross-talk between C/EBP pathway and iron metabolism
J Biol Chem
(2002) - et al.
Effect of hepcidin on intestinal iron absorption in mice
Blood
(2004) - et al.
Synthetic hepcidin causes rapid dose-dependent hypoferremia and is concentrated in ferroportin-containing organs
Blood
(2005) - et al.
Disrupted hepcidin regulation in HFE-associated haemochromatosis and the liver as a regulator of body iron homoeostasis
Lancet
(2003) - et al.
Expression of hepcidin in hereditary hemochromatosis: evidence for a regulation in response to serum transferrin saturation and non-transferrin-bound iron
Blood
(2003) - et al.
Hepcidin, a putative mediator of anemia of inflammation, is a type II acute-phase protein
Blood
(2003) - et al.
Two signals are necessary for cell proliferation induced by a cytokine receptor gp130: involvement of STAT3 in anti-apoptosis
Immunity
(1996)
Acquiring signalling specificity from the cytokine receptor gp130
Trends Genet
Lack of gp130 expression in hepatocytes promotes liver injury
Gastroenterology
Adsorption, simple binding and complex binding of rat hepatocytes to various in vitro substrata
Exp Cell Res
Number and evolutionary conservation of alpha- and beta-tubulin and cytoplasmic beta- and gamma-actin genes using specific cloned cDNA probes
Cell
Interleukin-6/glycoprotein 130-dependent pathways are protective during liver regeneration
J Biol Chem
Inappropriate expression of hepcidin is associated with iron refractory anemia: implications for the anemia of chronic disease
Blood
Interleukin-6 induces hepcidin expression through STAT3
Blood
A role of SMAD4 in iron metabolism through the positive regulation of hepcidin expression
Cell Metab
Smad proteins suppress CCAAT/enhancer-binding protein (C/EBP) beta- and STAT3-mediated transcriptional activation of the haptoglobin promoter
J Biol Chem
Hepcidin in iron metabolism
Curr Opin Hematol
Cited by (0)
Supported by a Telethon grant No. 0644015372 and the SFB 542, Teilprojekt C14.