Table 1.

Primers used for genotyping.

SNPForward PrimerReverse Primer ExtensionDirection of PrimerSingle-strand Extension
rs6889239ACGTTGGATGTTACGCACCTGTGCATCAAGACGTTGGATGCTCTCCCAAGCATCATTTCCRCTCCTGTGCCCAGTGCC
rs2233311ACGTTGGATGTTGTGTCATTTGGCTCCACCACGTTGGATGCGTGCAAGTGGCTTCTAGTTFAGAGCCAGCTGATCTCA
rs3792789ACGTTGGATGGAAACAGTTTTTGTCTTGGGACGTTGGATGGGGACCTCAGAAGGGTTTGFCCTTGGGAGGAAGGTGC
rs960709ACGTTGGATGTCAGGCCCCCAGAGTTCCGTACGTTGGATGTATGGGTCTTTTCAGCTCGGRTTAAGAAGAGTCCTGGAG
rs12658895ACGTTGGATGGAAAGACTGGACTAGACTGGACGTTGGATGTGCAGTCCATTCCGCCTCTTRCTCTTCCCATGGATCTCAC
rs871269ACGTTGGATGAATTAATTCCTGAGCTCCCGACGTTGGATGCTGGGGATCTGGCAGTGAAFtGCTGGGACCCCTAACCAT
rs8177834ACGTTGGATGAGTGGAGAGAGGCCTCATCACGTTGGATGCACTCTTAGGATTGCTGCTCRCTCCTGGAGGCTTCTGCAA
rs888989ACGTTGGATGGGAATTGTGGCCACTCACAGACGTTGGATGGAGAGGCAGGGACTTGATTGFGAGCAAGGAGGCCCAAGTTC
rs13168551ACGTTGGATGTGTGTGCTTGGTCCACTGTAACGTTGGATGCAGTGGTGTTTTCTGCAAGGFTCCACTGTACCAAGTTGTCTT
rs7708392ACGTTGGATGGCCAACTGGTCAATTCTCCCACGTTGGATGGGGTCTCTTCTGGAACTTAGFaAGAGGCTGATTCCAGTTATT
rs10463312ACGTTGGATGTGGCTCCATTTCTGCACAACACGTTGGATGACAGGGAGGCCAAGTCCATCRccCCAAGTCCATCGCAACATGA
rs12655899ACGTTGGATGACAAGGGCAAGTCGCTCCCAACGTTGGATGTCTTCCTTGAATGCCCCGAGRaCCGAGCCAGATGCTCTTCCTGC
rs13153275ACGTTGGATGAAAAGAGGATCTCCATGGGCACGTTGGATGGCCAGGGAAACATGCTGATARcTGCTGATAAATGGTGAAAGTCT
rs4958437ACGTTGGATGAGGTAAACACCGGCTGCCTGACGTTGGATGAAGTCGCTCCTAGAGGGGAAFGCGGTGTCTCTCGTCCC
rs918498ACGTTGGATGCATCCATCCTGCACATGCACACGTTGGATGCTCCAGAGTTCCTACTATACFGCACATGCACACAAATG
rs2277940ACGTTGGATGAAGGAGGGACCCAGGAAAGACGTTGGATGGAAGATCAACATTCTGACTCFGGTTGACAGGGGAACAT
rs4958436ACGTTGGATGATATGCCAGCTCCAAGTGACACGTTGGATGATTTAATGAGCAGCTACTGTGRACTGTGTGCCAGGCATCGC
rs10036748ACGTTGGATGCTTTCATAGCATGATACACGACGTTGGATGGCAAAGCAGCCCCTTTTTTCRCTTTTTTCACTTTCTGTCAC
rs6862024ACGTTGGATGGTGCTGGGACTAGAGGATAGACGTTGGATGAGGGTGTTGGCTAGTGTCTGRGTGATGCTGCAGGGCTGGCC